콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU068301

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAACATCATCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGTAG

Ensembl | 인체 수납 번호

ENSG00000197442

NCBI 수납 번호

NM_005923

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MAP3K5(4217) , MAP3K5(4217)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BAV
VBS
XPR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yongwei Yao et al.
Biochemical and biophysical research communications, 493(3), 1288-1295 (2017-10-03)
Interleukin-33 (IL-33), a new member of the IL-1 cytokine family, has cardiac protective effect in many circumstances. The aims of present study are to assess whether IL-33 can protect cardiomyocytes from doxorubicin (DOX)-induced apoptosis and the mechanism involved in the
Liwei Ma et al.
Journal of experimental & clinical cancer research : CR, 38(1), 77-77 (2019-02-15)
Metformin, a first-line drug for type 2 diabetes, could induce apoptosis in cancer cells. However, the concentration of glucose affects the effect of metformin, especially low glucose in the culture medium can enhance the cytotoxicity of metformin on cancer cells.
Mathew S Eapen et al.
Clinical science (London, England : 1979), 132(14), 1615-1627 (2018-07-15)
Increased airway smooth muscle (ASM) mass is observed in chronic obstructive pulmonary disease (COPD), which is correlated with disease severity and negatively affects lung function in these patients. Thus, there is clear unmet clinical need for finding new therapies which
Musarat Ishaq et al.
Biochimica et biophysica acta, 1843(12), 2827-2837 (2014-09-01)
Atmospheric pressure gas plasma (AGP) generates reactive oxygen species (ROS) that induce apoptosis in cultured cancer cells. The majority of cancer cells develop a ROS-scavenging anti-oxidant system regulated by Nrf2, which confers resistance to ROS-mediated cancer cell death. Generation of
Chiara Imarisio et al.
Free radical biology & medicine, 112, 141-148 (2017-07-26)
Steatosis intensifies hepatic ischemia/reperfusion (I/R) injury increasing hepatocyte damage and hepatic inflammation. This study evaluates if this process is associated to a differential response of steatotic hepatocytes (HP) and Kupffer cells (KC) to I/R injury and investigates the molecular mechanisms
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.