콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU068071

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC8A3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACCGCTTCATGGCATCTATTGAAGTCATCACCTCTCAAGAGAGGGAGGTGACAATTAAGAAACCCAATGGAGAAACCAGCACAACCACTATTCGGGTCTGGAATGAAACTGTCTCCAACCTGACCCTTATGGCCCTGGGTTCCTCTGCTCCTGAGATACTCCTCTCTTTAATTGAGGTGTGTGGTCATGGGTTCATTGCTGGTGATCTGGGACCTTCTACCATTGTAGGGAGTGCAGCCTTCAACATGTTCATCATCATTGGCATCTGTGTCTACGTGATCCCAGACGGAGAGACTCGCAAGATCAAGCATCTACGAGTCTTCTTCATCACCGCTGCTTGGAGTATCTTTGCCTACATCTGGCTCTATATGATTCTGGCAGTCTTCTCCCCTGGTGTGGTCCAGGTTTGGGAAGGCCTCCTCACTCTCTTCTTCTTTCCAGTGTGTGTCCTTCTGGCCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury
Giulia Di Benedetto et al.
The FEBS journal, 286(4), 737-749 (2018-12-16)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine belonging to the TNF superfamily, is regarded as a mediator of neurotoxicity. The constitutively expressed ion exchanger Na+ /Ca2+ exchanger isoform-3 (NCX3) has been shown to protect neurons from injury. Its expression

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.