추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATCTTGGGCAAGTCAGTCAGATATACAGATATGGAGAGTGAAGATTACCACTTCTACCAAGGTCTGGTTTATCTGCTGGAAAATGATGTCTCCACACTAGGCTATGACCTCACCTTCAGCACTGAGGTCCAAGAGTTTGGAGTTTGTGAAGTTCGTGACCTCAAACCCAATGGGGCCAACATCTTGGTAACAGAGGAGAATAAGAAGGAGTATGTACACCTGGTATGCCAGATGAGAATGACAGGAGCCATCCGCAAGCAGTTGGCGGCTTTCTTAGAAGGCTTCTATGAGATCATTCCAAAGCGCCTCATTTCCATCTTCACTGAGCAGGAGTTAGAGCTGCTTATATCAGGACTGCCCACCATTGACATCGATGATCTGAAATCCAACACTGAATACCACAAGTACCAGTCCAACTCTATTCAGATCCAGTGGTTCTGGAGAGCATTGCGTTCTTTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HUWE1(10075) , HUWE1(10075)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Michael J Friez et al.
BMJ open, 6(4), e009537-e009537 (2016-05-01)
X linked intellectual disability (XLID) syndromes account for a substantial number of males with ID. Much progress has been made in identifying the genetic cause in many of the syndromes described 20-40 years ago. Next generation sequencing (NGS) has contributed to
Matthias Bosshard et al.
Scientific reports, 7(1), 15050-15050 (2017-11-10)
Mutations in the HECT, UBA and WWE domain-containing 1 (HUWE1) E3 ubiquitin ligase cause neurodevelopmental disorder X-linked intellectual disability (XLID). HUWE1 regulates essential processes such as genome integrity maintenance. Alterations in the genome integrity and accumulation of mutations have been
Dong Yang et al.
Theranostics, 8(13), 3517-3529 (2018-07-22)
Lung cancer is the most frequent cancer type and the leading cause of tumor-associated deaths worldwide. TP53 is an important tumor suppressor gene and is frequently inactivated in lung cancer. E3 ligases targeting p53, such as MDM2, are involved in
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Lisa J Crawford et al.
Oncogene, 39(27), 5001-5014 (2020-06-12)
Proteasome inhibitors have provided a significant advance in the treatment of multiple myeloma (MM). Consequently, there is increasing interest in developing strategies to target E3 ligases, de-ubiquitinases, and/or ubiquitin receptors within the ubiquitin proteasome pathway, with an aim to achieve
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.