콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU065681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP8A2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTTCATGGAGCCTGGAGCTACAACCGGGTGACCAAGTGCATCTTGTACTGCTTCTATAAGAACGTGGTCCTGTATATTATTGAGCTTTGGTTCGCCTTTGTTAATGGATTTTCTGGGCAGATTTTATTTGAACGTTGGTGCATCGGCCTGTACAATGTGATTTTCACCGCTTTGCCGCCCTTCACTCTGGGAATCTTTGAGAGGTCTTGCACTCAGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGGCGAAGGCTTCAACACAAAGGTTTTCTGGGGTCACTGCATCAACGCCTTGGTCCACTCCCTCATCCTCTTCTGGTTTCCCATGAAAGCTCTGGAGCATGATACTGTGTTGACAAGTGGTCATGCTACCGACTATTTATTTGTTGGAAATATTGTTTACACATATGTTGTTGTTACTGTTTGTCTGAAAGCTGGTTTGGAGACC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

A Dorronsoro et al.
Cell death & disease, 4, e972-e972 (2013-12-21)
The zinc-finger protein A20 is a key player in the negative feedback regulation of the nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-κB) pathway in response to multiple stimuli. Tumor necrosis factor alpha (TNFα), a cytokine with pleiotropic effects on cellular
Kerstin Boengler et al.
Basic research in cardiology, 105(6), 771-785 (2010-10-21)
The signal transducer and activator of transcription 3 (STAT3) contributes to cardioprotection by ischemic pre- and postconditioning. Mitochondria are central elements of cardioprotective signaling, most likely by delaying mitochondrial permeability transition pore (MPTP) opening, and STAT3 has recently been identified
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.