설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATCCAAGCCAGGGCTGAGCAGGAAGAAGAATTCATTAGTAACACTTTATTCAAGAAAATTCAGGCTTTGCAGAAGGAGAAAGAAACCCTTGCTGTAAATTATGAGAAAGAAGAAGAATTCCTCACTAATGAGCTCTCCAGAAAATTGATGCAGTTGCAGCATGAGAAAGCCGAACTAGAACAGCATCTTGAACAAGAGCAGGAATTTCAGGTCAACAAACTGATGAAGAAAATTAAAAAACTGGAGAATGACACCATTTCTAAGCAACTTACATTAGAACAGTTGAGACGGGAGAAGATTGACCTTGAAAATACATTGGAACAAGAACAAGAAGCACTAGTTAATCGCCTCTGGAAAAGGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CCDC6(8030) , CCDC6(8030)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Francesco Morra et al.
Lung cancer (Amsterdam, Netherlands), 135, 56-65 (2019-08-27)
CCDC6 (coiled-coil domain containing 6) is a player of the HR response to DNA damage and has been predicted to interact with BAP1, another HR-DNA repair gene highly mutated in Malignant Pleural Mesothelioma (MPM), an aggressive cancer with poor prognosis.
Francesco Morra et al.
Oncotarget, 8(19), 31815-31829 (2017-04-19)
Reduced levels of the tumor suppressor protein CCDC6 sensitize cancer cells to the treatment with PARP-inhibitors. The turnover of CCDC6 protein is regulated by the de-ubiquitinase USP7, which also controls the androgen receptor (AR) stability. Here, we correlated the expression
Francesco Morra et al.
Oncotarget, 6(14), 12697-12709 (2015-04-18)
CCDC6 gene product is a pro-apoptotic protein substrate of ATM, whose loss or inactivation enhances tumour progression. In primary tumours, the impaired function of CCDC6 protein has been ascribed to CCDC6 rearrangements and to somatic mutations in several neoplasia. Recently
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.