설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATGGACACAGCCATTATGCCTCTGAGTCGCTTCCCTCCAAGAAGGACCAGGAGGAGGGGGTGATGGAGAAGCTGCAGAACGGGGACCTGGACCACATGATTCCTCAGCACTGCAGCAGTGAGCTGGACGGCAAGGCGCCCATGGTGGACGAGAAGGTCATTGTGGGCTCGCTCTCTGTGCAGGACCTGCAGGCTTCCCAGAGTGCTTGCTACTGGCTGAAAGGTGTCCGCTACTCTGATATCGGCACTCTGGCCTGGATGATCACTCTGAGCGACGGCCTCCATAATTTCATCGATGGCCTGGCCATCGGTGCTTCCTTCACTGTGTCAGTTTTCCAAGGCATCAGCACCTCGGTGGCCATCCTCTGTGAGGAGTTCCCACATGAGCTAGGAGACTTTGTCATCCTGCTCAACG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLC39A14(23516) , SLC39A14(23516)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tolunay Beker Aydemir et al.
The Journal of biological chemistry, 291(46), 23939-23951 (2016-10-21)
Zinc influences signaling pathways through controlled targeted zinc transport. Zinc transporter Zip14 KO mice display a phenotype that includes impaired intestinal barrier function with low grade chronic inflammation, hyperinsulinemia, and increased body fat, which are signatures of diet-induced diabetes (type
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular
Yu Han et al.
Metallomics : integrated biometal science, 12(3), 346-362 (2020-01-18)
Zinc is the second most abundant transition metal in humans and an essential nutrient required for growth and development of newborns. During lactation, mammary epithelial cells differentiate into a secretory phenotype, uptake zinc from blood circulation, and export it into
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.