콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU062171

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGCCAAGCATAAGGTCTGCCGAAGCCTTGGCGTTCTCAGACTGCCGGCTGCACATCTGCCTGTACTACCGGGAAATCCTCGTGAAGGAGCTGACCACGTCCAGCCCCGAGGGCTGCCGGATCTCCCATGGACATACGTATGACGCCAGCAACCTGGACCAGGTCCTGTTCCCCTACCCAGAGGACAATGGCCAGAGGAAAAACATTGAGAAGCTGCTGAGCCACCTGGAGAGGGGCGTGGTCCTCTGGATGGCCCCCGACGGGCTCTATGCGAAAAGACTGTGCCAGAGCAGGATCTACTGGGACGGGCCCCTGGCGCTGTGCAACGACCGGCCCAACAAACTGGAGAGAGACCAGACCTGCAAGCTCTTTGACACACAGCAGTTCTTGTCAGAGCTGCAAGCGTTTGCTCACCACGGCCGCTCCCTGCCAAGATTCCAGGTGACTCTATGCTTTGGAGAGGAGTTTCCAGACCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Takuya Yashiro et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11481-11491 (2019-07-18)
C-C chemokine receptor type 7 (CCR7) is essential for migration of dendritic cells (DCs) to draining lymph nodes. PU.1/Spi1 is a transcription factor playing a critical role in the gene regulation of DCs. PU.1 knockdown decreased the expression of CCR7
Takuya Yashiro et al.
Scientific reports, 9(1), 1161-1161 (2019-02-06)
The chemokine CCL22 is predominantly produced by dendritic cells (DCs) and macrophages. CCL22 acts on CCR4-expressing cells including Th2 and Treg. Although a correlation between the CCL22-CCR4 axis and allergic diseases has been established, the mechanism of monocyte lineage-specific Ccl22
T Watanabe et al.
Mucosal immunology, 7(6), 1312-1325 (2014-03-29)
It is well established that polymorphisms of the caspase activation and recruitment domain 15 (CARD15) gene, a major risk factor in Crohn's disease (CD), lead to loss of nucleotide-binding oligomerization domain 2 (NOD2) function. However, a molecular explanation of how
Sorim Nam et al.
Journal of leukocyte biology, 100(6), 1273-1284 (2016-09-08)
Myeloid-derived suppressor cells (MDSCs) are immature cells that do not differentiate into mature myeloid cells. Two major populations of PMN-MDSCs (Ly6G
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.