콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU061761

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCAGCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCTATTTGGACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTTGGCCAGCCAACTCTGGGAATACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAAGGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTCTCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACCAATCTCTGAATGCCCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display
Narisa Chan et al.
Scientific reports, 5, 11777-11777 (2015-07-01)
The cytoplasmic mutant of nucleophosmin (NPMc) is found approximately in one-third of acute myeloid leukemia (AML) cases and is highly associated with normal karyotype. Whereas previous studies have focused on wtNPM in centrosome duplication, we further elucidate the role of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.