설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGACTGACCCCTGCACAGACAGACCCCTTCCCCTCTCTGCGAAAGGACCAAGCCCCAGAAGTCACTCCATCTCCTACGGCTCGCAATTTCCAGAGGCCCCCTGGCACCTTCCAGCCTGATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RIPK3(11035) , RIPK3(11035)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Diego Martin-Sanchez et al.
Scientific reports, 7, 41510-41510 (2017-02-01)
Iron deficiency has been associated with kidney injury. Deferasirox is an oral iron chelator used to treat blood transfusion-related iron overload. Nephrotoxicity is the most serious and common adverse effect of deferasirox and may present as an acute or chronic
Alessandra Pescatore et al.
Cell death & disease, 7(8), e2346-e2346 (2016-08-26)
Incontinentia Pigmenti (IP) is a rare X-linked disease characterized by early male lethality and multiple abnormalities in heterozygous females. IP is caused by NF-κB essential modulator (NEMO) mutations. The current mechanistic model suggests that NEMO functions as a crucial component
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.