설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGACGTCGATTGACTGGTCTTCAGAAGCAGAAGGACTCCATGAAAGATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAGCTGGACATCAAGAAGAACGAGCGGCTGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGGGTGAGGAACGCGGCCAACAGGACGGGCTATGTACCGTCCAACTACGTGGAGCGGAAGAACAGCCTGAAGAAGGGCTCCCTCGTGAAGAACCTGAAGGACACACTAGGCCTCGGCAAGACGCGCAGGAAGACCAGCGCGCGGGATGCGTCCCCCACGCCCAGCACGGACGCCGAGTACCCCGCCAATGGCAGCGGCGCCGACCGCATCTACGACCTCAACATCCCGGCCTTCGTCAAGTTCGCCTATGTGGCCGAGCGGGAGGATGAGTTGTCCCTGGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NCK2(8440) , NCK2(8440)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Alexandre Dubrac et al.
Nature communications, 9(1), 3463-3463 (2018-08-29)
Pericytes are mural cells that surround capillaries and control angiogenesis and capillary barrier function. During sprouting angiogenesis, endothelial cell-derived platelet-derived growth factor-B (PDGF-B) regulates pericyte proliferation and migration via the platelet-derived growth factor receptor-β (PDGFRβ). PDGF-B overexpression has been associated
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.