설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGAAAGAGGGTCCTGAAACCAGGCTGAGCCCCCAGCCAGAGCCAGAGCCAATGCTGGAGCCGGATCAGAAGCGCAGCCTGGAGTCCTCGCCAGCTCCCGAACGCCTGTGCTCTTTCTGCAAACACAACGGCGAGTCCCGGGCCATCTACCAGTCCCACGTGCTGAAGGACGAGGCTGGCAGGGTGCTGTGTCCCATCCTGCGGGACTACGTGTGTCCCCAGTGCGGCGCCACACGTGAGCGCGCCCACACCCGACGCTTCTGCCCACTTACTGGCCAGGGCTACACCTCCGTCTACAGCCACACCACCCGAAACTCGGCAGGCAAGAAGCTGGTCCGGCCTGACAAGGCGAAGACACAGGAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NANOS3(342977) , NANOS3(342977)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Paul Guerby et al.
Redox biology, 22, 101126-101126 (2019-02-10)
Decreased nitric oxide (NO) bioavailability plays a critical role in the pathophysiology of preeclampsia (PE). Recent evidence indicates that S-glutathionylation may occur on the endothelial nitric oxide synthase (eNOS), leading to eNOS uncoupling, characterized by a decreased NO production and
Ye Tian et al.
Endocrinology, 158(6), 1898-1915 (2017-03-23)
Thyroid hormones are important for normal reproductive function. Although 3,5,3'-triiodothyronine (T3) enhances follicle-stimulating hormone (FSH)-induced preantral follicle growth and granulosa cells development in vitro, little is known about the molecular mechanisms regulating ovarian development via glucose. In this study, we
Yaqiu Li et al.
American journal of physiology. Cell physiology, 318(3), C463-C475 (2020-01-01)
Published studies indicate that TMEM184A is a heparin receptor that interacts with and transduces stimulation from heparin in vascular cells. Previous studies have indicated that heparin increases endothelial nitric oxide synthase (eNOS) activity in bovine endothelial cells. However, the precise
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.