설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCGGACCCACACATTACCTTGTGTTTGCAAGATCTGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGGGGAGAAGCCTTTTTCTTGCCCTCACTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTGTGTAGCACACTGAGTGACGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATAGACACACACACATATGCACACACACACACACACACCCACAGAGAGAGAGCTGCAAGAGCATGGAATTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SNAI2(6591) , SNAI2(6591)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Carla L Alves et al.
Breast cancer research : BCR, 20(1), 60-60 (2018-06-21)
Endocrine resistance in estrogen receptor-positive (ER+) breast cancer is a major clinical problem and is associated with accelerated cancer cell growth, increased motility and acquisition of mesenchymal characteristics. However, the specific molecules and pathways involved in these altered features remain
Di-Di Chen et al.
American journal of physiology. Gastrointestinal and liver physiology, 317(2), G147-G160 (2019-04-04)
Invasion and metastasis are responsible for the majority of deaths in gastric cancer (GC). microRNA-33a (miR-33a) might function as a tumor suppressor in multiple cancers. Here, we describe the regulation and function of miR-33a in GC and mechanisms involved in
Dong Hyun Jo et al.
Oncotarget, 8(9), 15441-15452 (2017-01-07)
Retinoblastoma is the most common intraocular cancer in children, affecting 1/20,000 live births. Currently, children with retinoblastoma were treated with chemotherapy using drugs such as carboplatin, vincristine, and etoposide. Unfortunately, if conventional treatment fails, the affected eyes should be removed
Mijung Kwon et al.
Oncotarget, 7(47), 77052-77070 (2016-10-25)
Filamin A interacting protein 1-like (FILIP1L) is an inhibitor of the canonical WNT pathway. WNT/β-catenin signaling and its downstream pathway, epithelial-to-mesenchymal transition (EMT), play a key role in ovarian cancer metastasis and chemoresistance. To study the clinical implications of FILIP1L
Ziliang Wang et al.
Oncotarget, 6(9), 6670-6683 (2015-03-10)
While Aurora-A (Aur A) provokes, BRCA2 restrains primary tumorigenesis, the roles of Aur A and BRCA2 in cancer metastasis remains unclear. Here, we show that the metastatic promoting markers SLUG, FBN1, and MMP2, 9, 13 are either stimulated or suppressed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.