추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGTCCCTGAAAAGGTGCATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCGGTTATGATGGGGTGAAAAGGTGGACCAAAAACGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCATCCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTATTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGCATATTGCCAAGTATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTTACTTCAAAATGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCAGCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACTGCAAA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SENP3(26168) , SENP3(26168)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Y Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2778-2786 (2018-05-18)
To investigate whether SENP3 protects H9C2 cells from apoptosis triggered by H/R through the signal transducer and activator of transcription 3 (STAT3) pathway. Male C57BL mice were cultured and mouse models of myocardial I/RI were established. At the same time
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Jia Luo et al.
The Journal of toxicological sciences, 42(5), 529-538 (2017-07-28)
Increased post-translational modification of proteins by SUMO-2/3 is a cytoprotective response against cell stress induced by ischaemia and reperfusion. However, it is still unclear what other cell stressors trigger protein SUMOylation, what mechanisms enhance and maintain the enhanced SUMOylation, and
Chun-Jie Huang et al.
Biochimica et biophysica acta, 1864(7), 1195-1206 (2017-03-21)
Understanding the mechanisms underlying abnormal egg production and pregnancy loss is significant for human fertility. SENP7, a SUMO poly-chain editing enzyme, has been regarded as a mitotic regulator of heterochromatin integrity and DNA repair. Herein, we report the roles of
Arnab Nayak et al.
Cell reports, 27(9), 2725-2736 (2019-05-30)
Precise assembly of the sarcomere, a force-generating unit in striated muscles, is critical for muscle contraction. Defective sarcomere organization is linked to myopathies and cachexia. The molecular mechanisms concerning sarcomere assembly are poorly understood. Here, we report that the SUMO-specific
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.