콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU043151

Sigma-Aldrich

MISSION® esiRNA

targeting human KPNB1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGCATGGACTGTAGGCAGAATTTGTGAGCTGCTTCCTGAAGCTGCCATCAATGATGTCTACTTGGCTCCCCTGCTACAGTGTCTGATTGAGGGTCTCAGTGCTGAACCCAGAGTGGCTTCAAATGTGTGCTGGGCTTTCTCCAGTCTGGCTGAAGCTGCTTATGAAGCTGCAGACGTTGCTGATGATCAGGAAGAACCAGCTACTTACTGCTTATCTTCTTCATTTGAACTCATAGTTCAGAAGCTCCTAGAGACTACAGACAGACCTGATGGACACCAGAACAACCTGAGGAGTTCTGCATATGAATCTCTGATGGAAATTGTGAAAAACAGTGCCAAGGATTGTTATCCTGCTGTCCAGAAAACGACTTTGGTCATCATGGAACGACTGCAACAGGTTCTTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Noboru Sekimoto et al.
Journal of Cancer, 8(19), 4125-4140 (2017-12-01)
Lung cancer is a major cause of death worldwide, with lung adenocarcinoma being the most frequently diagnosed subtype in Japan. Finding the target of an anticancer drug can improve lung adenocarcinoma treatments. Polo-like kinase 1 (PLK1) is an essential mitotic
Michiko Kodama et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(35), E7301-E7310 (2017-08-16)
Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has not been changed significantly during several decades. To seek new therapeutic targets for EOC, we performed an in vivo dropout screen in human tumor xenografts using a pooled
Zhen Wang et al.
Emerging microbes & infections, 9(1), 2030-2045 (2020-09-03)
The interferon-inducible myxovirus resistance B (MxB) protein has been reported to inhibit HIV-1 and herpesviruses by blocking the nuclear import of viral DNA. Here, we report a new antiviral mechanism in which MxB restricts the nuclear import of HIV-1 regulatory
Aihua Dai et al.
Neurochemical research, 40(11), 2177-2187 (2015-08-26)
Kpnb1, also known as Importin β1, is a member of the Karyopherin protein family which plays a important role in nuclear import and export pathways. Its expression has been shown to be responsive to stress, such as heat shock, ethanol

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.