추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTGTCACCTTCGTCCTGAATGACCACAGCATGGCCTTCACTGGAGATGCCCTGTTGATCCGTGGGTGTGGGCGGACAGACTTCCAGCAAGGCTGTGCCAAGACCTTGTACCACTCGGTCCATGAAAAGATCTTCACACTTCCAGGAGACTGTCTGATCTACCCTGCTCACGATTACCATGGGTTCACAGTGTCCACCGTGGAGGAGGAGAGGACTCTGAACCCTCGGCTCACCCTCAGCTGTGAGGAGTTTGTCAAAATCATGGGCAACCTGAACTTGCCTAAACCTCAGCAGATAGACTTTGCTGTTCCAGCCAACATGCGCTGTGGGGTGCAGACACCCACTGCCTGATCTCACTTCTGTCAGATGCTCCCATCCACTATTAATGCACTAGGTGGGAGGAGAGGGCGGCAATGACACTGCACCTCTCCTTTCCCACCGCATTCCCTGGAGCTCCCTAAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ETHE1(23474) , ETHE1(23474)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yuhui Hao et al.
Scientific reports, 6, 38942-38942 (2016-12-15)
The purpose of this study was to investigate the underlying mechanism of metallothionein (MT) protection from depleted uranium (DU) using a proteomics approach to search for a DU toxicity-differential protein. MT-/- and MT+/+ mice were administrated with a single dose
Yuhui Hao et al.
Journal of biochemical and molecular toxicology, 35(3), e22669-e22669 (2020-12-05)
The kidney is the target of the acute toxicity of depleted uranium (DU). However, the mechanism of DU-induced cytotoxicity is not clear. The study was to demonstrate the role of autophagy in DU-induced cytotoxicity and to determine the potential mechanism.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.