설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGGTTCAAGTGGTGGGATTACAGGAACGGGAGGTCAAATGTGTTGAAGATGTACTGAAACTCATTGACATAGGCAACAGTTGCAGAACATCCGGTCAAACATCTGCAAATGCACATTCATCTCGGAGCCATGCAGTGTTTCAGATTATTCTTAGAAGGAAAGGAAAACTACATGGCAAATTTTCTCTCATTGATTTGGCTGGAAATGAAAGAGGAGCTGATACTTCCAGTGCGGACAGGCAAACTAGGCTTGAAGGTGCTGAAATTAATAAAAGCCTTTTAGCACTCAAGGAGTGCATCAGAGCCTTAGGTAGAAATAAACCTCATACTCCTTTCCGTGCAAGTAAACTCACTCAGGTGTTAAGAGATTCTTTCATAGGTGAAAACTCTCGTACCTGCATGATTGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... KIF2A(3796) , KIF2A(3796)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ming-Huang Chen et al.
Scientific reports, 6, 39337-39337 (2016-12-20)
KIF2A, a member of the kinesin-13 family, has been reported to play a role in spindle assembly in mitosis. However, its function in mammalian meiosis remains unknown. In this research, we examined the expression, localization and function of KIF2A during
Baobiao Zhuo et al.
Biochemical and biophysical research communications, 464(2), 401-406 (2015-06-28)
Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.