설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACCTGGATGTGTCAGGATGCTCCAAAGTGACCTGCATCAGCTTGACCCGGGAGGCCTCCATTAAACTGTCACCCTTGCATGGCAAACAGATTTCCATCCGCTACCTGGACATGACGGACTGCTTCGTGCTGGAGGACGAAGGCCTGCACACCATCGCGGCGCACTGCACGCAGCTCACCCACCTCTACCTGCGCCGCTGCGTCCGCCTGACCGACGAAGGCCTGCGCTACCTGGTGATCTACTGCGCCTCCATCAAGGAGCTGAGCGTCAGCGACTGCCGCTTCGTCAGCGACTTCGGCCTGCGGGAGATCGCCAAGCTGGAGTCCCGCCTGCGGTACCTGAGCATCGCGCACTGCGGCCGGGTCACCGACGTGGGCATCCGCTACGTGGCCAAGTACTGCAGCAAGCTGCGCTACCTCAACGCGAGGGGCTGCGAGGGCATCACGGACCACGGTGTGGAGTACCT
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FBXL7(23194) , FBXL7(23194)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Hui-Wen Chiu et al.
Journal of clinical medicine, 7(10) (2018-10-12)
Paclitaxel (PTX) is a common regimen used to treat patients with ovarian cancer. Although approximately 60% of ovarian cancer patients exhibit a pathologic complete response (pCR), approximately 40% of patients appear to be insensitive to PTX adjuvant therapy. Thus, identifying
Loredana Moro et al.
Nature cell biology, 22(9), 1130-1142 (2020-08-26)
Epigenetic plasticity is a pivotal factor that drives metastasis. Here, we show that the promoter of the gene that encodes the ubiquitin ligase subunit FBXL7 is hypermethylated in advanced prostate and pancreatic cancers, correlating with decreased FBXL7 mRNA and protein
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.