설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATGACCTGGCCAAGTTGAAGGTGGCAATCAAATACCACCAGAAAGAGTTTGTTGCTCAGCCCAACTGCCAACAGTTGCTTGCCACCCTGTGGTATGATGGCTTCCCTGGATGGCGGCGGAAACACTGGGTAGTCAAGCTTCTAACCTGCATGACCATTGGGTTCCTGTTTCCCATGCTGTCTATAGCCTACCTGATCTCACCCAGGAGCAACCTTGGGCTGTTCATCAAGAAACCCTTTATCAAGTTTATCTGCCACACAGCATCCTATTTGACCTTCCTCTTTATGCTTCTCCTGGCTTCTCAGCACATTGTCAGGACAGACCTTCATGTACAGGGGCCTCCCCCAACTGTCGTGGAATGGATGATATTGCCTTGGGTTCTAGGTTTCATTTGGGGTGAGATTAAGGAAATGTGGGATGGTGGATTTACTGAATACATCCATGACTGGTGGAACCTGATGGATTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TRPC5(7224) , TRPC5(7224)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yan Zou et al.
Oncology reports, 41(6), 3413-3423 (2019-04-04)
Temozolomide (TMZ) is the first choice chemotherapy agent against glioblastoma, but the TMZ chemotherapy resistance has restricted the clinical application. Although autophagy is considered an adaptive response for cell survival under the pressure of chemotherapy and associated with chemotherapy resistance
Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Peng Zhang et al.
Scientific reports, 7(1), 3158-3158 (2017-06-11)
Adriamycin is a first-line chemotherapy agent against cancer, but the development of resistance has become a major problem. Although autophagy is considered to be an adaptive survival response in response to chemotherapy and may be associated with chemoresistance, its inducer
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.