콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU035381

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jing Jin et al.
Cell cycle (Georgetown, Tex.), 18(22), 3125-3136 (2019-10-01)
Jixuepaidu Tang-1 is obtained from the decoction of the Chinese traditional medicinal plants including Centella asiatica, Astragalus membranaceus, and Sanguis draconis. Transforming growth factor-β1 (TGF-β1)/serum- and glucocorticoid-inducible kinase-1 (SGK1)-induced epithelial-mesenchymal transition (EMT) plays a pivotal role in the pathogenesis of
Nadeshda Schelski et al.
Pflugers Archiv : European journal of physiology, 471(6), 889-899 (2019-02-02)
The serum- and glucocorticoid-inducible kinase 1 (SGK1) is a key regulator of osteo-/chondrogenic transdifferentiation and subsequent calcification of vascular smooth muscle cells (VSMCs). The phenotypical transdifferentiation of VSMCs is associated with increased interleukin-18 (IL-18) levels and generalized inflammation. Therefore, the
Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Takamitsu Miyayama et al.
Environmental toxicology and pharmacology, 38(2), 374-378 (2014-08-17)
In HK-2 cells exposed to cadmium chloride (CdCl2), the level of serum- and glucocorticoid-inducible kinase-1 (SGK1) protein is increased, but the levels of SGK2 and SGK3 proteins are not. Phosphorylation of SGK1 protein is also observed. Treatment with actinomycin D

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.