설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAAGGGAGACGAGTGTGAGCTCCTAGGACATAGCAAGAACATCCGCACTGTGGTGACAGGCATTGAGATGTTCCACAAGAGCCTGGAGAGGGCCGAGGCCGGAGATAACCTCGGGGCCCTGGTCCGAGGCTTGAAGCGGGAGGACTTGCGGCGGGGCCTGGTCATGGTCAAGCCAGGTTCCATCAAGCCCCACCAGAAGGTGGAGGCCCAGGTTTACATCCTCAGCAAGGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCACTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGGATTATCCTGCCCCCAGAGAAGGAGCTTGCCATGCCCGGGGAGGACCTGAAGTTCAACCTAATCTTGCGGCAGCCAATGATCTTAGAGAAAGGCCAGCGTTTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TUFM(7284) , TUFM(7284)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Xiaoyuan Weng et al.
Oncology letters, 20(5), 250-250 (2020-10-01)
Gastrointestinal stromal tumors (GISTs) are the most common pathologic type of mesenchymal tumor in the digestive tract. Patients with GIST face the risk of metastasis, postoperative recurrence and imatinib mesylate (IM) resistance. Mitochondrial Tu translation elongation factor (TUFM) is highly
Dasol Kim et al.
Communications biology, 4(1), 1-1 (2021-01-06)
Disorders of autophagy, a key regulator of cellular homeostasis, cause a number of human diseases. Due to the role of autophagy in metabolic dysregulation, there is a need to identify autophagy regulators as therapeutic targets. To address this need, we
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.