콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU033391

Sigma-Aldrich

MISSION® esiRNA

targeting human MGMT

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Thatchawan Thanasupawat et al.
Molecular oncology, 11(8), 1078-1098 (2017-05-14)
The multikinase inhibitor and FDA-approved drug dovitinib (Dov) crosses the blood-brain barrier and was recently used as single drug application in clinical trials for GB patients with recurrent disease. The Dov-mediated molecular mechanisms in GB cells are unknown. We used
Jin Cheng et al.
Toxicology, 389, 67-73 (2017-07-20)
N-methyl-2,2-di(chloroethyl)amine (HN2) is a kind of bifunctional alkyltating agent, which can react with nucleophilic groups in DNA and/or protein to form HN2-bridged crosslinking of target molecules, such as DNA-protein crosslinkings (DPC). O
Xinwei Li et al.
Pathology oncology research : POR, 26(2), 707-714 (2019-02-04)
Primary central nervous system lymphoma (PCNSL) is an aggressive and rare subtype of non-Hodgkin lymphoma, arising exclusively in the CNS with a poor prognosis. Previous evidence has proved that MGMT was a promising target involving in TMZ resistance of PCNSL.
Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Boswellic acid has anti-inflammatory effects and enhances the anticancer activities of Temozolomide and Afatinib, an irreversible ErbB family blocker, in human glioblastoma cells.
Manlio Barbarisi et al.
Phytotherapy research : PTR, 33(6), 1670-1682 (2019-03-30)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.