콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU028931

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSG

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATAATCAGCGGACCATCCAGAATGACATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGCTCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGGCAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAGGGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGGGGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAACAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTTCACCAGGGTCTCAAGTTTCCTGCCCTGGATA

Ensembl | 인체 수납 번호

ENSG00000100448

NCBI 수납 번호

NM_001911

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CTSG(1511) , CTSG(1511)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
KSU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Kyung Ho Han et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(2), 738-747 (2015-10-21)
We have devised a method of using intracellular combinatorial libraries to select antibodies that control cell fates. Many agonist antibodies have been selected with this method, and the process appears to be limited only by the availability of a phenotypic
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
S K Sengodan et al.
Oncogenesis, 6(9), e376-e376 (2017-09-05)
Human chorionic gonadotropin β (β-hCG) has been implicated in breast tumorigenesis. However, the role of this hormone is highly controversial as certain studies suggest it has anti-tumor properties while others have found it to be pro-tumorigenic. To unveil the truth
Sudha Saryu Malhotra et al.
Scientific reports, 5, 11210-11210 (2015-06-09)
The aim of the present study is to delineate the role of human chorionic gonadotropin (hCG) in trophoblast fusion. In this direction, using shRNA lentiviral particles, α- and β-hCG silenced 'BeWo' cell lines were generated. Treatment of both α- and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.