설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCTGTCAACTCCACCAAGTCATCGTTGCTCGGTTTGCAGATGACCAGCTCATCATCGATTTTGATAATTTTGTTCGGTGTTTGGTTCGGCTGGAAACGCTATTCAAGATATTTAAGCAGCTGGATCCCGAGAATACTGGAACAATAGAGCTCGACCTTATCTCTTGGCTCTGTTTCTCAGTACTTTGAAGTTATAACTAATCTGCCTGAAGACTTCTCATGATGGAAAATCAGCCAAGGACTAAGCTTCCATAGAAATACACTTTGTATCTGGACCTCAAAATTATGGGAACATTTACTTAAACGGATGATCATAGCTGAAAATAATGATACTGTCAATTTGAGATAGCAGAAGTTTCACACATCAAAGTAAAAGATTTGCATATCATTATACTAAATGCAAATGAGTCGCTTAACCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CAPN2(824) , CAPN2(824)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this
Sheng Wang et al.
The Journal of biological chemistry, 292(20), 8291-8303 (2017-04-01)
Capsaicin is an ingredient in spicy peppers that produces burning pain by activating transient receptor potential vanilloid 1 (TRPV1), a Ca2+-permeable ion channel in nociceptors. Capsaicin has also been used as an analgesic, and its topical administration is approved for
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.