콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU023531

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTGGACC

Ensembl | 인체 수납 번호

ENSG00000139687

NCBI 수납 번호

NM_000321

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RB1(5925) , RB1(5925)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
LUU
BDU
XUT
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Toshiyuki Sumi et al.
Biochemical and biophysical research communications, 501(1), 253-258 (2018-05-05)
High expression levels of survivin in KRAS-mutant lung adenocarcinomas are linked with unfavorable patient outcomes, suggesting that survivin is a promising target for tumor treatment. We found that trametinib, a MEK inhibitor, downregulates survivin expression in the RB1-positive KRAS-mutant lung
Chun-Yu Liu et al.
PloS one, 12(12), e0189007-e0189007 (2017-12-21)
Triple negative breast cancer (TNBC) lacks specific drug targets and remains challenging. Palbociclib, a cyclin-dependent kinases 4 and 6 (CDK4/6) inhibitor is approved for metastatic estrogen receptor (ER)-positive and human epithermal growth factor 2 (HER2)-negative breast cancer. The nature of
Elisabetta Marangoni et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(11), 2605-2615 (2018-02-22)
Purpose: Triple-negative breast cancer (TNBC) patients with residual disease after neoadjuvant chemotherapy have a poor outcome. We developed patient-derived xenografts (PDX) from residual tumors to identify efficient chemotherapies and predictive biomarkers in a context of resistance to anthracyclines- and taxanes-based
Karen McColl et al.
Oncotarget, 8(43), 73745-73756 (2017-11-02)
The majority of small cell lung cancer (SCLC) patients demonstrate initial chemo-sensitivity, whereas a distinct subgroup of SCLC patients, termed chemo-refractory, do not respond to treatment. There is little understanding of how to distinguish these patients prior to disease treatment.
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.