콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU023041

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0C, RP11-20I23.1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAGCTGGGCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGACGCTGGCGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAGGTGCTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGAATATTATGTAAAGACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCCCCCAGTAGTTGGTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGCCCGCCCCGTGCCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAGTGCTCTGTGTATGCGGATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nicholas J Barrows et al.
Scientific reports, 9(1), 9711-9711 (2019-07-06)
Hundreds of cellular host factors are required to support dengue virus infection, but their identity and roles are incompletely characterized. Here, we identify human host dependency factors required for efficient dengue virus-2 (DENV2) infection of human cells. We focused on
Yuji Tani et al.
Scientific reports, 5, 10878-10878 (2015-06-04)
(Pro)renin receptor (PRR) has a single transmembrane domain that co-purifies with the vacuolar H(+)-ATPase (V-ATPase). In addition to its role in cellular acidification, V-ATPase has been implicated in membrane fusion and exocytosis via its Vo domain. Results from the present
Manuela Salerno et al.
PloS one, 9(10), e110340-e110340 (2014-10-21)
Rhabdomyosarcoma is the most frequent soft tissue sarcoma in children and adolescents, with a high rate of relapse that dramatically affects the clinical outcome. Multiagent chemotherapy, in combination with surgery and/or radiation therapy, is the treatment of choice. However, the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.