추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CUL4A(8451) , CUL4A(8451)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yidan Ren et al.
Respiratory research, 20(1), 84-84 (2019-05-08)
Chronic obstructive pulmonary disease (COPD) is a common respiratory disease with high morbidity and mortality. The most important pathophysiological change of COPD is airway obstruction. Airway obstruction can cause airflow restriction and obstructive ventilation dysfunction. Currently, many studies have shown
B Englinger et al.
British journal of cancer, 116(4), 489-500 (2017-01-18)
Colorectal carcinoma (CRC) is the third most common cancer worldwide. Platinum-based anticancer compounds still constitute one mainstay of systemic CRC treatment despite limitations due to adverse effects and resistance development. Trabectedin has shown promising antitumor effects in CRC, however, again
Laura P Saucedo-Cuevas et al.
Oncotarget, 5(8), 2330-2343 (2014-05-30)
The CUL4A E3 ubiquitin ligase is involved in the regulation of many cellular processes and its amplification and/or overexpression has been observed in breast cancer. The 13q34 amplification, which is associated with the basal-like breast cancer subtype, has been proposed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.