콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU015411

Sigma-Aldrich

MISSION® esiRNA

targeting human DAPK1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAAATGTATCCGCTGTCAACTACGAATTTGAGGATGAATACTTCAGTAATACCAGTGCCCTAGCCAAAGATTTCATAAGAAGACTTCTGGTCAAGGATCCAAAGAAGAGAATGACAATTCAAGATAGTTTGCAGCATCCCTGGATCAAGCCTAAAGATACACAACAGGCACTTAGTAGAAAAGCATCAGCAGTAAACATGGAGAAATTCAAGAAGTTTGCAGCCCGGAAAAAATGGAAACAATCCGTTCGCTTGATATCACTGTGCCAAAGATTATCCAGGTCATTCCTGTCCAGAAGTAACATGAGTGTTGCCAGAAGCGATGATACTCTGGATGAGGAAGACTCCTTTGTGATGAAAGCCATCATCCATGCCATCAACGATGACAATGTCCCAGGCCTGCAGCACCTTCTGGGCTCATTATCCA

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhenning Liu et al.
Immunologic research, 65(3), 687-698 (2017-02-20)
Paraquat can result in dysfunction of multiple organs after ingestion in human. However, the mechanisms of nucleotide-binding domain and leucine-rich repeat containing protein 3 (NLRP3) inflammasome activation in acute kidney injury have not been clearly demonstrated. The aim of this
Wei Xiong et al.
Journal of the neurological sciences, 387, 210-219 (2018-03-25)
Death-associated protein kinase 1 (DAPK1) is a kinase found to promote neuronal apoptosis induced by ischemia. Extracellular signal-regulated kinase (ERK) was identified as a key molecule in DAPK1 signaling. However, the mechanisms of neuronal ischemia reperfusion injury remain unknown. Here
Chang-Lin Zhai et al.
IUBMB life, 71(2), 166-176 (2018-11-13)
Cardiovascular ischemic disease is a large class of diseases that are harmful to human health. The significant role of microRNAs (miRNAs) in terms of controlling cardiac injury has been reported in latest studies. MiR-98 is very important in regulating the
Bang-Chuan Hu et al.
Theranostics, 10(25), 11479-11496 (2020-10-15)
Tubular damage initiated by inflammatory response and ischemic/hypoxic stress is a hallmark of septic acute kidney injury (AKI), albeit the molecular mechanism coupling the two events remains unclear. We investigated the intrinsic nature of tubular damage with respect to inflammatory/hypoxic
Jean-Cheng Kuo et al.
The Journal of cell biology, 172(4), 619-631 (2006-02-16)
Death-associated protein kinase (DAPK) is a calmodulin-regulated serine/threonine kinase and possesses apoptotic and tumor-suppressive functions. However, it is unclear whether DAPK elicits apoptosis-independent activity to suppress tumor progression. We show that DAPK inhibits random migration by reducing directional persistence and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.