콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU014941

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGCGTCTGGAAGAAATACAGCCTTACAGTTGCTGTGAAAACATTGAAGGAAGATACCATGGAGGTAGAAGAATTCCTGAAAGAAGCTGCAGTAATGAAGGAAATCAAGCATCCTAATCTGGTACAACTTTTAGGTGTGTGTACTTTGGAGCCACCATTTTACATTGTGACTGAATACATGCCATACGGGAATTTGCTGGATTACCTCCGAGAATGCAACCGAGAAGAGGTGACTGCAGTTGTGCTGCTCTACATGGCCACTCAGATTTCTTCTGCAATGGAGTACTTAGAGAAGAAGAATTTCATCCATAGAGATCTTGCAGCTCGTAACTGCCTAGTGGGAGAAAACCATGTGGTAAAAGTGGCTGACTTTGGCTTAAGTAGATTGATGACTGGAGACACTTATACTGCTCATGCTGGAGCCAAATTTCCTATTAAGTGGACAGCACCAGAGAGTCTTGCCTACAATACCTTCTCAATTAAATCTGACGTCTGGGCTTTTGGGGTATT

Ensembl | 인체 수납 번호

ENSG00000143322

NCBI 수납 번호

NM_007314

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ABL2(27) , ABL2(27)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
JUU
IDU
ALT
QCS
NRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

H Gil-Henn et al.
Oncogene, 32(21), 2622-2630 (2012-07-11)
Tumor progression is a complex, multistep process involving accumulation of genetic aberrations and alterations in gene expression patterns leading to uncontrolled cell division, invasion into surrounding tissue and finally dissemination and metastasis. We have previously shown that the Arg/Abl2 non-receptor
Xiu-Fen Ming et al.
Journal of the American Heart Association, 1(4), e000992-e000992 (2012-11-07)
Macrophage-mediated chronic inflammation is mechanistically linked to insulin resistance and atherosclerosis. Although arginase I is considered antiinflammatory, the role of arginase II (Arg-II) in macrophage function remains elusive. This study characterizes the role of Arg-II in macrophage inflammatory responses and
Takafumi Ichikawa et al.
Journal of cell science, 130(20), 3517-3531 (2017-09-03)
Vinexin, c-Cbl associated protein (CAP) and Arg-binding protein 2 (ArgBP2) constitute an adaptor protein family called the vinexin (SORBS) family that is targeted to focal adhesions (FAs). Although numerous studies have focused on each of the SORBS proteins and partially
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
Ewelina Testoni et al.
EMBO molecular medicine, 8(2), 105-116 (2016-01-14)
The lack of actionable mutations in patients with non-small cell lung cancer (NSCLC) presents a significant hurdle in the design of targeted therapies for this disease. Here, we identify somatically mutated ABL1 as a genetic dependency that is required to
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.