추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCCTGAAAGAAGCGGATCAAAAAGAACAGTTTTCCCAAGGATCTCCAAGCAACTGTCTGGAAACTTCTTTGGCAGAGATATTTCCTTTAGGAAAAAATCACAGCTCTAAAGTTAATTCAGACAGCGGTATTCCAGGATTAGCAGCCAGTGTCTTAGTTGTGAGTCACGGTGCTTACATGAGAAGTCTGTTTGATTATTTTCTGACTGACCTTAAGTGTTCCTTACCAGCCACTCTGAGCAGATCTGAACTTATGTCAGTCACTCCCAATACAGGGATGAGTCTCTTTATCATAAACTTTGAGGAAGGAAGAGAAGTTAAACCAACGGTTCAGTGTATTTGTATGAACCTACAGGATCATCTAAATGGACTGACTGAAACTCGCTAAGGTTAAATCTGCATCAAAATCTAACCATTTTGAGCCTCTGAAGGGAGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TIGAR(57103) , C12orf5(57103)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
Wen-feng Gou et al.
BMC cancer, 14, 477-477 (2014-07-06)
RhoC is a small G protein/GTPase and involved in tumor mobility, invasion and metastasis. Previously, up-regulated RhoC expression is found to play an important role in ovarian carcinogenesis and subsequent progression by modulating proliferation, apoptosis, migration and invasion. We transfected
Dao Chao Huang et al.
Endocrinology, 155(10), 3739-3749 (2014-07-23)
The role of PTHrP in the highly metastatic human melanoma disease is not known. This study investigates the mechanisms of action of this secreted factor through homozygous inactivation of the Pthrp gene in A375 human melanoma cells. In vitro, Pthrp-ablated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.