콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU002791

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB2, SERPINB10

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTCAGAACCCCAGGCAGTAGACTTCCTAGAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAGGCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCGGCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATAGAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTGTTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTGCTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAA

Ensembl | 인체 수납 번호

ENSG00000197632

NCBI 수납 번호

NM_002575

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SERPINB2(5055) , SERPINB2(5055)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BBV
ASU
XKT

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tiefeng Jin et al.
Oncotarget, 8(20), 32769-32782 (2017-04-22)
The microRNA-200 (miR-200) family is associated with tumor metastasis and poor patient prognosis. We found that miR-200c/141 cluster overexpression upregulated SerpinB2 in the MDA-MB-231 triple-negative (TN) breast cancer cell line. We observed transcription factor (c-Jun, c-Fos, and FosB) upregulation, nuclear
Eleonora Longhin et al.
Archives of toxicology (2018-07-11)
Exposure to particulate matter (PM) has been related to the onset of adverse health effects including lung cancer, but the underlying molecular mechanisms are still under investigation. Epithelial-to-mesenchymal transition (EMT) is regarded as a crucial step in cancer progression. In
Ziqi Meng et al.
International immunopharmacology, 81, 106028-106028 (2019-12-06)
To investigate the effect of miR-200c/PAI-2 on macrophage polarization into M2-type TAMs in TNBC. PAI-2 expression in MDA-MB-231con, MDA-MB-231miR-200ab and MDA-MB-231miR-200c breast cancer cells was evaluated by RT-PCR and immunofluorescence (IF), while the expression of the TAM marker F4/80 and
Na-Hee Lee et al.
Cell death & disease, 9(7), 724-724 (2018-06-22)
The toxicological evaluation of potential drug candidates is very important in the preclinical phase of drug development. Toxic materials may cause serious decline in stem cell function and loss of stemness. Indeed, we found that toxic exposure more profoundly suppressed
Chenying Zhang et al.
The Journal of cell biology, 209(2), 289-303 (2015-04-29)
Healing is delayed in diabetic wounds. We previously demonstrated that lineage-specific Foxo1 deletion in keratinocytes interfered with normal wound healing and keratinocyte migration. Surprisingly, the same deletion of Foxo1 in diabetic wounds had the opposite effect, significantly improving the healing
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.