Skip to Content
Merck
All Photos(1)

Key Documents

EMU077471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thbd

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCAGGCTCTTACTCCTGTATGTGTGAGACAGGCTACCAGTTGGCTGCAGACGGACACCGGTGTGAGGACGTGGATGACTGTAAGCAGGGGCCCAATCCATGTCCCCAGCTCTGTGTTAACACCAAGGGCGGCTTCGAATGCTTCTGCTATGATGGCTATGAGTTGGTGGATGGAGAGTGCGTGGAGCTTCTGGATCCGTGTTTCGGATCTAACTGCGAGTTTCAGTGCCAGCCAGTGAGCCCCACCGACTACCGATGCATCTGCGCTCCAGGCTTCGCACCCAAGCCGGATGAACCGCACAAGTGCGAAATGTTCTGCAATGAAACTTCGTGCCCAGCAGACTGTGACCCTAACTCTCCTACTGTTTGTGAATGCCCTGAAGGCTTCATCCTGGACGAGGGTTCCGTATGCACGGACATTGATGAGTGCAGTCAAGGCGAATGCTTCAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
E Klineberg et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 23(11), 2385-2392 (2014-04-18)
Noggin protein levels and spinal fusion rates were compared in a rabbit model after application of siRNA against BMP antagonist noggin in paraspinal muscle. To test whether endogenous BMPs are sufficient to form bone in the absence of their antagonists
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service