Skip to Content
Merck
All Photos(1)

Key Documents

EHU125681

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Liu et al.
Cancer letters, 430, 1-10 (2018-05-08)
Our previous work has demonstrated that extracellular ATP is an important pro-invasive factor, and in this study, we tapped into a possible mechanism involved. We discovered that ATP could upregulate both the intracellular expression and secretion of S100A4 in breast
Zuliang Jie et al.
Journal of immunology (Baltimore, Md. : 1950), 198(9), 3448-3460 (2017-04-02)
Although large amounts of vitamin A and its metabolite all-
Hong Xia et al.
The Journal of clinical investigation, 127(7), 2586-2597 (2017-05-23)
Idiopathic pulmonary fibrosis (IPF) is a progressive disease with a prevalence of 1 million persons worldwide. The fibrosis spreads from affected alveoli into contiguous alveoli and leads to death by asphyxiation. We previously discovered that the IPF lung harbors fibrogenic
Giridhar Mudduluru et al.
Oncotarget, 8(13), 21081-21094 (2017-04-21)
The S100 calcium-binding protein A4 (S100A4) induces epithelial mesenchymal transition, migration, invasion, angiogenesis and metastasis. Its induced expression in several cancer types correlates with poor prognosis. Apart from the functional and transcriptional regulatory aspects of S100A4, its post-transcriptional regulation is
Xuelong Jiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(3), 1143-1162 (2018-09-10)
Anaplastic thyroid cancer (ATC), with 25% BRAFV600E mutation, is one of the most lethal human malignancies that currently has no effective therapy. Vemurafenib, a BRAFV600E inhibitor, has shown promise in clinical trials, including ATC patients, but is being hampered by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service