Skip to Content
Merck
All Photos(1)

Key Documents

EHU075831

Sigma-Aldrich

MISSION® esiRNA

targeting human PRODH

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAAAGTGTCGCAAAGTTGGGCATCGCATCCAGGGCTGAGATTGAGGACTGGTTCACGGCAGAGACCCTGGGAGTGTCTGGCACCATGGACCTGCTGGACTGGAGCAGCCTCATCGACAGCAGGACCAAGCTGTCCAAGCACTTGGTAGTCCCCAACGCACAGACAGGACAGCTGGAGCCCCTGCTGTCCCGGTTCACTGAGGAGGAGGAGCTACAGATGACCAGGATGCTACAGCGGATGGATGTCCTGGCCAAGTTGCTCCCACTCTCCCACCCCCTGCGCCTCTCAGAAAGCCACAGAGATGGGCGTGCGGCTGATGGTGGATGCCGAGCAGACCTACTTCCAGCCGGCCATCAGCCGCCTGACGCTGGAGATGCAGCGGAAGTTCAATGTGGAGAAGCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ilona Zareba et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 670-684 (2017-09-25)
The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels.
Huiying Li et al.
Toxins, 11(4) (2019-04-19)
The toxicity and related mechanisms of aflatoxin B1 (AFB1) and aflatoxin M1 (AFM1) in the mouse kidney were studied, and the role of l-proline in alleviating kidney damage was investigated. In a 28-day toxicity mouse model, thirty mice were divided

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service