Skip to Content
Merck
All Photos(1)

Key Documents

EHU075571

Sigma-Aldrich

MISSION® esiRNA

targeting human TSLP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAAACCATCTTTATTATGGTCATATTTCACAGCACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chenyang Dai et al.
Experimental eye research, 182, 19-29 (2019-03-12)
Thymic stromal lymphopoietin (TSLP) is an interleukin 7 (IL-7)-like four helix bundle cytokine that plays diverse roles in the regulation of immune responses. In fungal infection, pattern recognition receptors (PRRs), including the cell surface Toll-like receptors (TLRs) and cytoplasmic NOD-like
Gaoshun Ni et al.
Cellular immunology, 312, 35-41 (2016-11-28)
The newly discovered intracytosolic pattern recognition receptor nucleotide-binding oligomerization domain 2 (NOD2) has been studied as an important indicator of T helper 2 (Th2) inflammation, and its effect on regulatory T (Treg) cells is likely to modulate the immune response.
Na-Ra Han et al.
Journal of clinical medicine, 8(9) (2019-09-05)
Thymic stromal lymphopoietin (TSLP) is crucial for Th2-mediated inflammation. Sepsis is a serious systemic inflammatory reaction with organ dysfunction by infection. However, the function of TSLP during sepsis is poorly understood. Thus, we investigated a role and regulatory mechanism of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service