Skip to Content
Merck
All Photos(1)

Key Documents

EHU061891

Sigma-Aldrich

MISSION® esiRNA

targeting human VTCN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGACCAGGGAGCCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTCTGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACAGGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTTCTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAAATAATGTGCCTCGGCCACAAAAAAGCATGCAAAGTCATTGTTACAACAGGGATCTACAGAACTATTTCACCACCAGATATGACCTAGTTTTATATTTCTGGGAGGAAATGAATTCATATCTAGAAGTCTGGAGTGAGCAAACAAGAGCAAGAAACAAAAAGAAGCCAAAAGCAGAAGGCTCCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lijie Dong et al.
Scientific reports, 9(1), 14854-14854 (2019-10-18)
B7-H4, as a member of the B7 superfamily, was overexpressed in various types of cancers. However, the effects of B7-H4 on the aggressiveness of HCC and the underlying mechanisms have not yet been fully explored. For this purpose, B7-H4 expression
Ling Wang et al.
Cancer cell international, 18, 100-100 (2018-07-17)
The expression of the immunoregulatory protein B7-H4 has been reported in many types of cancer, including breast cancer. However, its role in triple-negative breast cancer (TNBC), especially its correlation with patients' prognosis and chemoresistance remains unclear. The expression of B7-H4
Xinran Chen et al.
Cancer science, 107(7), 944-954 (2016-04-19)
B7-H4, one of the costimulatory molecules of the B7 family, has been found to be widely expressed in many kinds of tumor tissues and to play an important part in tumor progression and poor prognosis. However, the role of B7-H4
Yuichiro Sato et al.
Cancers, 11(5) (2019-05-06)
Pseudomonas fluorescens lectin (PFL), which belongs to the high mannose (HM)-binding OAAH (Oscillatoria agardhii agglutinin homologue) lectin family, induces cancer cell death. However, the detailed mechanisms underlying this process have not yet been elucidated. We found that PFL decreased various
Hai-Xia Peng et al.
BioMed research international, 2015, 326981-326981 (2015-06-17)
Colorectal cancer is one of the most common malignancies. Recent studies investigated that B7-H4 is highly expressed in various cancers. We aimed at exploring the effect of B7-H4 siRNA on proliferation, invasion, and migration of LOVO cells which expressed B7-H4

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service