Skip to Content
Merck
All Photos(1)

Key Documents

EHU007381

Sigma-Aldrich

MISSION® esiRNA

targeting human ONECUT2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGCTGGAAGAAATCAACACCAAAGAGGTGGCCCAGCGCATCACAGCGGAGCTGAAGCGCTACAGTATCCCCCAGGCGATCTTTGCGCAGAGGGTGCTGTGCCGGTCTCAGGGGACTCTCTCCGACCTGCTCCGGAATCCAAAACCGTGGAGTAAACTCAAATCTGGCAGGGAGACCTTCCGCAGGATGTGGAAGTGGCTTCAGGAGCCCGAGTTCCAGCGCATGTCCGCCTTACGCCTGGCAGCGTGCAAACGCAAAGAGCAAGAACCAAACAAAGACAGGAACAATTCCCAGAAGAAGTCCCGCCTGGTGTTCACTGACCTCCAACGCCGAACACTCTTCGCCATCTTCAAGGAGAACAAACGCCCGTCAAAGGAGATGCAGATCACCATTTCCCAGCAGCTGGGCCTGGAGCTCACAACCGTCAGCAACTTCTTCATGAACGCCCGGCGCCGCAGCCTGGAGAAGTGGCAAGACGATCTGAGCACAGGGGGCTCCTCGTCCACCTCCAGCACGTGTACCAAAGCATGATGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

G-H Wang et al.
European review for medical and pharmacological sciences, 24(18), 9378-9390 (2020-10-06)
Gastric cancer is a common malignancy, with high metastasis and poor prognosis. Our purpose was to explore potential molecular mechanisms of gastric cancer. A total of 10 pairs of gastric cancer tissues and adjacent normal gastric tissues were collected for
Haiyang Guo et al.
Nature communications, 10(1), 278-278 (2019-01-19)
Neuroendocrine prostate cancer (NEPC), a lethal form of the disease, is characterized by loss of androgen receptor (AR) signaling during neuroendocrine transdifferentiation, which results in resistance to AR-targeted therapy. Clinically, genomically and epigenetically, NEPC resembles other types of poorly differentiated
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service