EHU018301
MISSION® esiRNA
targeting human PPARGC1A (2)
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTTCAAACATATTTGAGAAGATAGATGAAGAGAATGAGGCAAACTTGCTAGCAGTCCTCACAGAGACACTAGACAGTCTCCCTGTGGATGAAGACGGATTGCCCTCATTTGATGCGCTGACAGATGGAGACGTGACCACTGACAATGAGGCTAGTCCTTCCTCCATGCCTGACGGCACCCCTCCACCCCAGGAGGCAGAAGAGCCGTCTCTACTTAAGAAGCTCTTACTGGCACCAGCCAACACTCAGCTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PPARGC1A(10891), PPARGC1A(10891)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.