Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU151571

Sigma-Aldrich

MISSION® esiRNA

targeting human TWIST1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATGCCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGGGCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGCGGCACCATCCTCACACCTCTGCATTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

W Liu et al.
European review for medical and pharmacological sciences, 21(17), 3787-3793 (2017-10-05)
Endometrial carcinoma is the most common malignancy of the female genital tract. Therefore, there is an urgent need to understand the molecular mechanism of its metastasis. This study is aimed to explore the function and underlying mechanism of miR-326 in
Wei Li et al.
Oncology reports, 37(1), 185-192 (2016-11-24)
High expression of high mobility group protein A2 (HMGA2) is correlated with the invasiveness of gastric cancer and is an independent prognostic factor. The reason may be that HMGA2 promotes epithelial-mesenchymal transition (EMT) and the acquisition of tumor stem cell properties, yet
Yutian Wang et al.
Frontiers in microbiology, 11, 1301-1301 (2020-07-01)
Staphylococcus aureus (S. aureus) infection-induced osteomyelitis is a great challenge in clinic treatment. Identification of the essential genes and biological processes that are specifically changed in mononuclear cells at an early stage of S. aureus osteomyelitis is of great clinical
Mairéad A Cleary et al.
Stem cells and development, 26(10), 751-761 (2017-03-17)
Human bone marrow-derived mesenchymal stem cells (BMSCs) are clinically promising to repair damaged articular cartilage. This study investigated TWIST1, an important transcriptional regulator in mesenchymal lineages, in BMSC chondrogenesis. We hypothesized that downregulation of TWIST1 expression is required for in
Cai M Roberts et al.
Scientific reports, 6, 37652-37652 (2016-11-24)
Epithelial ovarian cancer (EOC) is the most deadly gynaecologic malignancy due to late onset of symptoms and propensity towards drug resistance. Epithelial-mesenchymal transition (EMT) has been linked to the development of chemoresistance in other cancers, yet little is known regarding

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service