Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU147811

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2S

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAACGTGGAGAACCTACCCCCGCACATCATCCGCCTGGTGTACAAGGAGGTGACGACACTGACCGCAGACCCACCCGATGGCATCAAGGTCTTTCCCAACGAGGAGGACCTCACCGACCTCCAGGTCACCATCGAGGGCCCTGAGGGGACCCCATATGCTGGAGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCGAACGTGGGCGCCAATGGCGAGATCTGCGTCAACGTGCTCAAGAGGGACTGGACGGCTGAGCTGGGCATCCGACACGTACTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCCGAGTCTGCACTCAACGAGGAGGCGGGCCGCCTGCTCTTGGAGAACTACGAGGAGTATGCGGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shusaku Yoshimura et al.
Biochemical and biophysical research communications, 485(4), 820-825 (2017-03-05)
Ubiquitin-conjugating enzyme E2S (UBE2S), a family of E2 protein in the ubiquitin-proteasome system, is highly expressed in several types of cancers; however, its roles in oral squamous cell carcinoma (OSCC) have not yet been well elucidated. The purpose of this
Peng Kuang et al.
Scientific reports, 6, 37441-37441 (2016-12-03)
SAG/RBX2 and RBX1 are two family members of RING components of Cullin-RING ligases (CRLs), required for their enzymatic activity. Previous studies showed that SAG prefers to bind with CUL5, as well as CUL1, whereas RBX1 binds exclusively to CULs1-4. Detailed
Tsung-Han Lin et al.
Food & function, 8(4), 1558-1568 (2017-03-10)
We previously reported that the dietary flavonoids, luteolin and quercetin, might inhibit the invasiveness of cervical cancer by reversing epithelial-mesenchymal transition (EMT) signaling. However, the regulatory mechanism exerted by luteolin and quercetin is still unclear. This study analyzed the invasiveness
Jennifer L Franks et al.
PLoS biology, 18(12), e3000975-e3000975 (2020-12-12)
The anaphase-promoting complex/cyclosome (APC/C) is an E3 ubiquitin ligase and critical regulator of cell cycle progression. Despite its vital role, it has remained challenging to globally map APC/C substrates. By combining orthogonal features of known substrates, we predicted APC/C substrates
Qingshui Wang et al.
Biomolecules, 9(4) (2019-04-20)
Death Associated Protein Kinase 1 (DAPK1) is an important signaling kinase mediating the biological effect of multiple natural biomolecules such as IFN-γ, TNF-α, curcumin, etc. DAPK1 is degraded through both ubiquitin-proteasomal and lysosomal degradation pathways. To investigate the crosstalk between

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service