Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU119541

Sigma-Aldrich

MISSION® esiRNA

targeting human VRK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATCGGTACTGCCCAGAAGGAGTTCATAAAGAATACAAAGAAGACCCCAAAAGATGTCACGATGGCACTATTGAATTCACGAGCATCGATGCACACAATGGCGTGGCCCCATCAAGACGTGGTGATTTGGAAATACTTGGTTATTGCATGATCCAATGGCTTACTGGCCATCTTCCTTGGGAGGATAATTTGAAAGATCCTAAATATGTTAGAGATTCCAAAATTAGATACAGAGAAAATATTGCAAGTTTGATGGACAAATGTTTTCCTGAGAAAAACAAACCAGGTGAAATTGCCAAATACATGGAAACAGTGAAATTACTAGACTACACTGAAAAACCTCTTTATGAAAATTTACGTGACATTCTTTTGCAAGGACTAAAAGCTATAGGAAGTAAGGATGATGGCAAATTGGACCTCAGTGTTGTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tianhua Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109483-109483 (2019-10-20)
Lung cancer is the leading cause of cancer-related deaths. Ginsenoside Rg3 is the main ingredient of Ginseng which is used to treat non-small cell lung cancer (NSCLC). It has been found to enhance the efficiency of chemotherapy thereby reducing its
Gen Wang et al.
Breast cancer research and treatment, 175(3), 567-578 (2019-04-03)
In early stage, ERα-positive breast cancer, concurrent use of endocrine therapy and chemotherapy has not been shown to be superior to sequential use. We hypothesized that genetic biomarkers can aid in selecting patients who would benefit from chemo-endocrine therapy. Our
Takuyu Hashiguchi et al.
Molecular endocrinology (Baltimore, Md.), 30(10), 1070-1080 (2016-08-30)
Comparison of 11 human nuclear receptor amino acid sequences revealed a conserved phosphorylation motif within their DNA-binding domains as an intramolecular signal that regulates proteolytic degradation. Nuclear receptors use this signal to either degrade or proscribe degradation through either the
Sangsoon Park et al.
Science advances, 6(27) (2020-09-17)
Vaccinia virus-related kinase (VRK) is an evolutionarily conserved nuclear protein kinase. VRK-1, the single Caenorhabditis elegans VRK ortholog, functions in cell division and germline proliferation. However, the role of VRK-1 in postmitotic cells and adult life span remains unknown. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service