Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU098321

Sigma-Aldrich

MISSION® esiRNA

targeting human SYF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCACATTTTTGTGCTTGGATATAAGATGTATTTCTTGTAGTGAAGTTGTTTTGTAATCTACTTTGTATACATTCTAATTATATTATTTTTCTATGTATTTTAAATGTATATGGCTGTTTAATCTTTGAAGCATTTTGGGCTTAAGATTGCCAGCAGCACACATCAGATGCAGTCATTGTTGCTATCAGTGTGGAATTTGATAGAGTCTAGACTCGGGCCACTTGGAGTTGTGTACTCCAAAGCTAAGGACAGTGATGAGGAAGATGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng Shi et al.
Oncotarget, 8(51), 88453-88463 (2017-11-29)
SYF2, a known cell cycle regulator, is reported to be involved in cell cycle arrest by interacting with cyclin-D-type binding protein 1. In the present study, we investigated the role of SYF2 in human breast cancer (BC) progression. SYF2 was
Chia-Hsin Chen et al.
PloS one, 7(3), e33538-e33538 (2012-03-27)
Human p29 is a putative component of spliceosomes, but its role in pre-mRNA is elusive. By siRNA knockdown and stable overexpression, we demonstrated that human p29 is involved in DNA damage response and Fanconi anemia pathway in cultured cells. In
Youmao Tao et al.
Archives of biochemistry and biophysics, 688, 108406-108406 (2020-05-18)
Increasing evidence indicates that aberrantly expressed microRNAs play a role in tumorigenesis and progression of gastric cancer. Recently, a novel cancer-related microRNA, miR-621, was found to be involved in cancer pathogenesis. However, the precise molecular mechanisms underlying the oncogenic activity

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service