Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU093641

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB1I1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J Paul et al.
Mucosal immunology, 11(2), 427-436 (2017-06-15)
Intestinal fibrosis is a major complication in inflammatory bowel diseases, but the regulatory mechanism that inhibits fibrosis remains unclear. Here we demonstrate that Itch-/-myofibroblasts express increased amounts of profibrotic collagen type I and α-SMA in response to IL-17. Mechanistically, we
Razan Sheta et al.
Oncotarget, 8(47), 82506-82530 (2017-11-16)
The molecular basis of epithelial ovarian cancer (EOC) dissemination is still poorly understood. We have previously identified the hydrogen peroxide-inducible clone-5 (Hic-5) gene as hypomethylated in high-grade (HG) serous EOC tumors, compared to normal ovarian tissues. Hic-5 is a focal
Sonsoles Piera-Velazquez et al.
Rheumatology (Oxford, England), 59(10), 3092-3098 (2020-05-23)
SSc is a systemic fibrotic disease affecting skin, numerous internal organs and the microvasculature. The molecular pathogenesis of SSc tissue fibrosis has not been fully elucidated, although TGF-β1 plays a crucial role. The Hic-5 protein encoded by the TGF-β1-inducible HIC-5
Rishel B Vohnoutka et al.
Molecular biology of the cell, 30(25), 3037-3056 (2019-10-24)
Focal adhesion (FA)-stimulated reorganization of the F-actin cytoskeleton regulates cellular size, shape, and mechanical properties. However, FA cross-talk with the intermediate filament cytoskeleton is poorly understood. Genetic ablation of the FA-associated scaffold protein Hic-5 in mouse cancer-associated fibroblasts (CAFs) promoted

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service