Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU046781

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC5L

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTAACTCCACAGCGACAAGTTGTACAGACTCCAAACACAGTTCTCTCTACTCCATTCAGGACTCCTTCTAATGGAGCTGAAGGGCTGACTCCCCGGAGTGGAACAACTCCCAAACCAGTTATTAACTCTACTCCGGGTAGAACTCCTCTTCGAGACAAGTTAAACATTAATCCCGAGGATGGAATGGCAGACTATAGTGATCCCTCTTACGTGAAGCAGATGGAAAGAGAATCCCGAGAACATCTCCGTTTAGGGTTGTTGGGCCTTCCTGCCCCTAAGAATGATTTTGAAATTGTTCTACCAGAAAATGCCGAGAAGGAGCTGGAAGAACGTGAAATAGATGATACTTACATTGAAGATGCTGCTGATGTGGATGCTCGAAAGCAGGCCATACGAGATGCAGAGCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTCCAGAAAGATCTGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jia Li et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2475-2488 (2017-05-05)
Colorectal cancer (CRC) is the third leading cause of cancer-related death worldwide because the survival rate remains low. Cell division cycle 5-like (CDC5L) is highly expressed in some cancer cells, but the mechanism requires clarification. Human telomerase reverse transcriptase (hTERT)
Ziwei Zhang et al.
Journal of Cancer, 11(2), 353-363 (2020-01-04)
Cell division cycle 5-like (CDC5L) protein is a cell cycle regulator of the G2/M transition and has been reported to participate in the catalytic step of pre-messenger RNA (mRNA) splicing and DNA damage repair. Recently, CDC5L was also found to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service