Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU027981

Sigma-Aldrich

MISSION® esiRNA

targeting human GJA5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTATGGCCAGAAGCCTGAGGTGCCCAATGGAGTCTCACCAGGTCACCGCCTTCCCCATGGCTATCATAGTGACAAGCGACGTCTTAGTAAGGCCAGCAGCAAGGCAAGGTCAGATGACCTATCAGTGTGACCCTCCTTTATGGGAGGATCAGGACCAGGTGGGAACAAAGGAGGCTCAGAGAAGAAAGACGTGTCCCTTCTGAACTGATGCTTTCTCACTGTCATCACTGCTTGGCTCCTTTGAGCCCCGGGTCTCAATGACGTTGCTCATTAATTCTAGAAACTATAACCAGGGCTCTGGGATAGTAAGAGAGGTGACAACCCACCCAGACTGCAGTTCCCTCCCCACCCTCTACCCAGTATACGAAGCCTTTCAGATTACTCATGAAACAGGGTAGAGGGAAAGAAGGGAAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ping Dai et al.
Scientific reports, 4, 7323-7323 (2014-12-05)
The reprogramming of differentiated cells into induced pluripotent stem cells (iPSCs) can be achieved by ectopic expression of defined transcription factors (Oct3/4, Sox2, Klf4 and c-Myc). However, to date, some iPSCs have been generated using viral vectors; thus, unexpected insertional
Jacques-Antoine Haefliger et al.
Arteriosclerosis, thrombosis, and vascular biology, 37(11), 2136-2146 (2017-10-07)
Cx40 (Connexin40) forms intercellular channels that coordinate the electric conduction in the heart and the vasomotor tone in large vessels. The protein was shown to regulate tumoral angiogenesis; however, whether Cx40 also contributes to physiological angiogenesis is still unknown. Here

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service