Skip to Content
Merck
All Photos(1)

Key Documents

EMU071151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnfaip6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGATACCCCATTGTGAAACCTGGGCCCAACTGTGGATTTGGGAAAACGGGTATCATCGATTATGGAATCCGGCTCAACAGGAGTGAGCGGTGGGATGCCTATTGCTACAATCCACATGCAAAGGAGTGTGGTGGTGTCTTCACAGATCCGAAGCGAATTTTTAAATCCCCGGGCTTCCCAAATGAGTACGATGACAACCAGGTCTGCTACTGGCACATTCGGCTCAAGTACGGTCAGCGAATTCACCTGAGCTTTTTGGACTTTGACCTTGAACATGATCCAGGCTGCTTGGCTGACTATGTAGAAATCTATGACAGTTATGATGACGTCCACGGCTTTGTAGGAAGATACTGTGGTGATGAACTTCCAGAAGACATCATTAGCACAGGAAATGTCATGACCTTGAAGTTTCTGAGTGATGCATCCGTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yi Liu et al.
Journal of neuroinflammation, 11, 135-135 (2014-08-05)
Microglia are the primary immunocompetent cells in brain tissue and microglia-mediated inflammation is associated with the pathogenesis of various neuronal disorders. Recently, many studies have shown that mesenchymal stem cells (MSCs) display a remarkable ability to modulate inflammatory and immune
Yi Liu et al.
Biochemical and biophysical research communications, 450(4), 1409-1415 (2014-07-12)
Dendritic cells (DCs) are potent antigen-presenting cells (APCs) that are characterized by the ability to take up and process antigens and prime T cell responses. Mesenchymal stem cells (MSCs) are multipotent cells that have been shown to have immunomodulatory abilities

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service