Skip to Content
Merck
All Photos(1)

Key Documents

EMU012511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Slc1a7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCCTCACCGTGGCATACTACCTGTGGACTACCTTTCTGGCTGTTGTTGTGGGCATCATCATGGTCTCCATCATCCACCCTGGTGGTGCAGCACAGAAGGAGACAACTGAACAGAGTGGAAAGCCGGTCATGAGCTCAGCTGATGCCCTCCTGGATCTTGTCCGGAACATGTTCCCAGCCAACCTGGTAGAAGCCACGTTCAAACAGTACCGCACCAAGACCACCCCAGTTATCAAGTCTCCCAGGGGAGCAGCGGAGGAGGCTCCCCGGCGGATCGTCATCTATGGGGTCCAGGAAGACAATGGCTCACGTGTGCAGAACTTTGCCCTGGATCTGACGCCCCCACCTGAGATTGTCTACAAGTCAGAGCCTGGTACCAGTGATGGCATGAACGTGCTAGGCATTGTCATCTTCTCAGCCACG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aoula Al-Zebeeby et al.
Haematologica, 104(5), 1016-1025 (2018-11-24)
BH3 mimetics are novel targeted drugs with remarkable specificity, potency and enormous potential to improve cancer therapy. However, acquired resistance is an emerging problem. We report the rapid development of resistance in chronic lymphocytic leukemia cells isolated from patients exposed
Michael L Schulte et al.
Nature medicine, 24(2), 194-202 (2018-01-16)
The unique metabolic demands of cancer cells underscore potentially fruitful opportunities for drug discovery in the era of precision medicine. However, therapeutic targeting of cancer metabolism has led to surprisingly few new drugs to date. The neutral amino acid glutamine
Florian Beaumatin et al.
Molecular cell, 76(1), 163-176 (2019-09-08)
Sensing nutrient availability is essential for appropriate cellular growth, and mTORC1 is a major regulator of this process. Mechanisms causing mTORC1 activation are, however, complex and diverse. We report here an additional important step in the activation of mTORC1, which

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service