Skip to Content
Merck
All Photos(1)

Key Documents

EHU154301

Sigma-Aldrich

MISSION® esiRNA

targeting human PLD2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGAGTCTGCTCCCTCTGGCTCGATTTGCCGTTGCCTATTCTCCAGCCCGAGATGCAGGCAACAGAGAGATGCCCTCTCTACCCCGGGCAGGTCCTGAGGGCTCCACCAGACATGCAGCCAGCAAACAGAAATACCTGGAGAATTACCTCAACCGTCTCTTGACCATGTCTTTCTATCGCAACTACCATGCCATGACAGAGTTCCTGGAAGTCAGTCAGCTGTCCTTTATCCCGGACTTGGGCCGCAAAGGACTGGAGGGGATGATCCGGAAGCGCTCAGGTGGCCACCGTGTTCCTGGCCTCACCTGCTGTGGCCGAGACCAAGTTTGTTATCGCTGGTCCAAGAGGTGGCTGGTGGTGAAGGACTCCTTCCTGCTGTACATGTGCCTCGAGACAGGTGCCATCTCATTTGTTCAGCTCTTTGACCCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Raja-Elie E Abdulnour et al.
Journal of leukocyte biology, 103(5), 919-932 (2018-02-14)
Phospholipase D (PLD) plays important roles in cellular responses to tissue injury that are critical to acute inflammatory diseases, such as the acute respiratory distress syndrome (ARDS). We investigated the expression of PLD isoforms and related phospholipid phosphatases in patients
Chang Sup Lee et al.
BMB reports, 49(3), 191-196 (2016-01-29)
Vascular endothelial growth factor (VEGF) is a key mediator of angiogenesis and critical for normal embryonic development and repair of pathophysiological conditions in adults. Although phospholipase D (PLD) activity has been implicated in angiogenic processes, its role in VEGF signaling
Rochelle K Nelson et al.
Scientific reports, 7(1), 9112-9112 (2017-08-24)
The Phospholipase D (PLD) superfamily is linked to neurological disease, cancer, and fertility, and a recent report correlated a potential loss-of-function PLD2 polymorphism with hypotension. Surprisingly, PLD2 -/- mice exhibit elevated blood pressure accompanied by associated changes in cardiac performance
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service