Skip to Content
Merck
All Photos(1)

Key Documents

EHU129111

Sigma-Aldrich

MISSION® esiRNA

targeting human DBI

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Long-Long Cao et al.
Journal of Alzheimer's disease : JAD, 68(3), 1095-1111 (2019-03-19)
Alzheimer's disease (AD) is reported to be associated with the accumulation of calcium ions (Ca2+), which is responsible for the phosphorylation of tau. Although a series of evidence have demonstrated this phenomenon, the inherent mechanisms remain unknown. Using tauP301S and
Govindasamy-Muralidharan Karthik et al.
Cancer letters, 367(1), 76-87 (2015-07-26)
Breast cancer cells with stem cell characteristics (CSC) are a distinct cell population with phenotypic similarities to mammary stem cells. CSCs are important drivers of tumorigenesis and the metastatic process. Tamoxifen is the most widely used hormonal therapy for estrogen

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service