Skip to Content
Merck
All Photos(1)

Key Documents

EHU047911

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCB10

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGACAAGACTCGCACAGGAGAATTGATTAACCGCCTCTCATCAGACACTGCACTCCTGGGGCGCTCAGTGACTGAAAACCTCTCAGATGGGCTCAGGGCCGGGGCCCAGGCTTCCGTAGGCATCAGTATGATGTTTTTTGTCTCACCTAATCTGGCCACCTTTGTTTTGAGCGTGGTGCCTCCAGTGTCAATCATTGCTGTAATTTATGGGCGATATCTACGGAAACTGACCAAAGTCACTCAGGATTCCCTGGCACAAGCCACTCAGCTAGCTGAGGAACGTATTGGAAATGTAAGAACTGTTCGAGCTTTTGGGAAAGAAATGACTGAAATCGAGAAATATGCCAGCAAAGTGGACCATGTAATGCAGTTAGCAAGGAAAGAGGCATTCGCCCGGGCTGGTTTCTTTGGAGCAACTGGGCTCTCCGGAAACCTGATCGTGCTTTCTGTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

W-Q Zhang et al.
European review for medical and pharmacological sciences, 24(11), 6088-6096 (2020-06-24)
Circ-ABCB10 is a non-coding RNA newly discovered in recent years. It has been observed to serve as an oncogene in a variety of tumors, but its biological function in esophageal squamous cell carcinoma (ESCC) is still unknown. The purpose of
Xuefang Lin et al.
Molecular medicine reports, 23(5) (2021-03-25)
Circular RNA ABCB10 (circ‑ABCB10) modulates cellular functions and microRNA (miR)‑1271 in epithelial ovarian cancer (EOC). The present study aimed to investigate the interaction between circ‑ABCB10 and miR‑1271 in regulating EOC cellular function and the calpain small subunit 1 (Capn4)/Wnt/β‑catenin signaling pathway.
Yan Chen et al.
Cancer biomarkers : section A of Disease markers, 26(2), 151-161 (2019-08-06)
This study aimed to explore the correlation of circular RNA ABCB10 (circ-ABCB10) expression with clinicopathological features and survival, as well as its impact on regulating cell proliferation and apoptosis in epithelial ovarian cancer (EOC). A total of 103 EOC patients

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service