Skip to Content
Merck
All Photos(1)

Key Documents

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AHR(196) , AHR(196)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Collynn F Woeller et al.
The American journal of pathology, 186(12), 3189-3202 (2016-11-16)
Thyroid eye disease (TED) is a degenerative disease that manifests with detrimental tissue remodeling, myofibroblast accumulation, and scarring in the orbit of affected individuals. Currently, there are no effective therapies for TED that target or prevent the excessive tissue remodeling
Guillaume Lano et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Endogenous agonists of the transcription factor aryl hydrocarbon receptor (AHR) such as the indolic uremic toxin, indoxyl sulfate (IS), accumulate in patients with chronic kidney disease. AHR activation by indolic toxins has prothrombotic effects on the endothelium, especially via tissue
Sean A Piwarski et al.
Biochemical pharmacology, 174, 113845-113845 (2020-02-08)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor. Triple negative breast cancer (TNBC) is the most aggressive breast cancer subtype. TNBC expresses AHR and AHR ligands have anti-cancer activity in TNBC. The aggressiveness of TNBC is due in
Laura Lozza et al.
Scientific reports, 9(1), 10878-10878 (2019-07-28)
As a first host barrier, the skin is constantly exposed to environmental insults that perturb its integrity. Tight regulation of skin homeostasis is largely controlled by the aryl hydrocarbon receptor (AhR). Here, we demonstrate that Henna and its major pigment

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service